ID: 1140960000

View in Genome Browser
Species Human (GRCh38)
Location 16:79902594-79902616
Sequence TCCACAAACGCAGTGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140960000_1140960005 15 Left 1140960000 16:79902594-79902616 CCATATTCCACTGCGTTTGTGGA No data
Right 1140960005 16:79902632-79902654 CTCTGGACAAGAAAACTTCGAGG No data
1140960000_1140960006 19 Left 1140960000 16:79902594-79902616 CCATATTCCACTGCGTTTGTGGA No data
Right 1140960006 16:79902636-79902658 GGACAAGAAAACTTCGAGGCAGG No data
1140960000_1140960002 -2 Left 1140960000 16:79902594-79902616 CCATATTCCACTGCGTTTGTGGA No data
Right 1140960002 16:79902615-79902637 GAGCAGAATCCCGTGAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140960000 Original CRISPR TCCACAAACGCAGTGGAATA TGG (reversed) Intergenic