ID: 1140960002

View in Genome Browser
Species Human (GRCh38)
Location 16:79902615-79902637
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140960001_1140960002 -9 Left 1140960001 16:79902601-79902623 CCACTGCGTTTGTGGAGCAGAAT No data
Right 1140960002 16:79902615-79902637 GAGCAGAATCCCGTGAACTCTGG No data
1140959997_1140960002 18 Left 1140959997 16:79902574-79902596 CCATCTCTGACCTGGTGGCTCCA No data
Right 1140960002 16:79902615-79902637 GAGCAGAATCCCGTGAACTCTGG No data
1140960000_1140960002 -2 Left 1140960000 16:79902594-79902616 CCATATTCCACTGCGTTTGTGGA No data
Right 1140960002 16:79902615-79902637 GAGCAGAATCCCGTGAACTCTGG No data
1140959998_1140960002 8 Left 1140959998 16:79902584-79902606 CCTGGTGGCTCCATATTCCACTG No data
Right 1140960002 16:79902615-79902637 GAGCAGAATCCCGTGAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140960002 Original CRISPR GAGCAGAATCCCGTGAACTC TGG Intergenic