ID: 1140960005

View in Genome Browser
Species Human (GRCh38)
Location 16:79902632-79902654
Sequence CTCTGGACAAGAAAACTTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140960001_1140960005 8 Left 1140960001 16:79902601-79902623 CCACTGCGTTTGTGGAGCAGAAT No data
Right 1140960005 16:79902632-79902654 CTCTGGACAAGAAAACTTCGAGG No data
1140959998_1140960005 25 Left 1140959998 16:79902584-79902606 CCTGGTGGCTCCATATTCCACTG No data
Right 1140960005 16:79902632-79902654 CTCTGGACAAGAAAACTTCGAGG No data
1140960000_1140960005 15 Left 1140960000 16:79902594-79902616 CCATATTCCACTGCGTTTGTGGA No data
Right 1140960005 16:79902632-79902654 CTCTGGACAAGAAAACTTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140960005 Original CRISPR CTCTGGACAAGAAAACTTCG AGG Intergenic
No off target data available for this crispr