ID: 1140960006

View in Genome Browser
Species Human (GRCh38)
Location 16:79902636-79902658
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140959998_1140960006 29 Left 1140959998 16:79902584-79902606 CCTGGTGGCTCCATATTCCACTG No data
Right 1140960006 16:79902636-79902658 GGACAAGAAAACTTCGAGGCAGG No data
1140960000_1140960006 19 Left 1140960000 16:79902594-79902616 CCATATTCCACTGCGTTTGTGGA No data
Right 1140960006 16:79902636-79902658 GGACAAGAAAACTTCGAGGCAGG No data
1140960001_1140960006 12 Left 1140960001 16:79902601-79902623 CCACTGCGTTTGTGGAGCAGAAT No data
Right 1140960006 16:79902636-79902658 GGACAAGAAAACTTCGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140960006 Original CRISPR GGACAAGAAAACTTCGAGGC AGG Intergenic