ID: 1140966612

View in Genome Browser
Species Human (GRCh38)
Location 16:79972517-79972539
Sequence CAGGCCATCCTGATGCTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140966612_1140966616 -2 Left 1140966612 16:79972517-79972539 CCCCAAAGCATCAGGATGGCCTG No data
Right 1140966616 16:79972538-79972560 TGTTAGAAATGCAGATTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140966612 Original CRISPR CAGGCCATCCTGATGCTTTG GGG (reversed) Intergenic
No off target data available for this crispr