ID: 1140967035

View in Genome Browser
Species Human (GRCh38)
Location 16:79976930-79976952
Sequence ATGAATGAAGAGTTTTGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140967035_1140967042 30 Left 1140967035 16:79976930-79976952 CCAAACCAAAACTCTTCATTCAT No data
Right 1140967042 16:79976983-79977005 ATTTCCTTCTTCCACGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140967035 Original CRISPR ATGAATGAAGAGTTTTGGTT TGG (reversed) Intergenic