ID: 1140967037

View in Genome Browser
Species Human (GRCh38)
Location 16:79976955-79976977
Sequence GAGGAAGAGTTTAGAATGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140967037_1140967042 5 Left 1140967037 16:79976955-79976977 CCCCACATTCTAAACTCTTCCTC No data
Right 1140967042 16:79976983-79977005 ATTTCCTTCTTCCACGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140967037 Original CRISPR GAGGAAGAGTTTAGAATGTG GGG (reversed) Intergenic