ID: 1140967038

View in Genome Browser
Species Human (GRCh38)
Location 16:79976956-79976978
Sequence AGAGGAAGAGTTTAGAATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140967038_1140967042 4 Left 1140967038 16:79976956-79976978 CCCACATTCTAAACTCTTCCTCT No data
Right 1140967042 16:79976983-79977005 ATTTCCTTCTTCCACGTTAATGG No data
1140967038_1140967045 30 Left 1140967038 16:79976956-79976978 CCCACATTCTAAACTCTTCCTCT No data
Right 1140967045 16:79977009-79977031 TAACCACCACCCCATTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140967038 Original CRISPR AGAGGAAGAGTTTAGAATGT GGG (reversed) Intergenic