ID: 1140967038 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:79976956-79976978 |
| Sequence | AGAGGAAGAGTTTAGAATGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1140967038_1140967042 | 4 | Left | 1140967038 | 16:79976956-79976978 | CCCACATTCTAAACTCTTCCTCT | No data | ||
| Right | 1140967042 | 16:79976983-79977005 | ATTTCCTTCTTCCACGTTAATGG | No data | ||||
| 1140967038_1140967045 | 30 | Left | 1140967038 | 16:79976956-79976978 | CCCACATTCTAAACTCTTCCTCT | No data | ||
| Right | 1140967045 | 16:79977009-79977031 | TAACCACCACCCCATTGCTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1140967038 | Original CRISPR | AGAGGAAGAGTTTAGAATGT GGG (reversed) | Intergenic | ||