ID: 1140967039

View in Genome Browser
Species Human (GRCh38)
Location 16:79976957-79976979
Sequence CAGAGGAAGAGTTTAGAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140967039_1140967042 3 Left 1140967039 16:79976957-79976979 CCACATTCTAAACTCTTCCTCTG No data
Right 1140967042 16:79976983-79977005 ATTTCCTTCTTCCACGTTAATGG No data
1140967039_1140967045 29 Left 1140967039 16:79976957-79976979 CCACATTCTAAACTCTTCCTCTG No data
Right 1140967045 16:79977009-79977031 TAACCACCACCCCATTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140967039 Original CRISPR CAGAGGAAGAGTTTAGAATG TGG (reversed) Intergenic