ID: 1140967042

View in Genome Browser
Species Human (GRCh38)
Location 16:79976983-79977005
Sequence ATTTCCTTCTTCCACGTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140967036_1140967042 25 Left 1140967036 16:79976935-79976957 CCAAAACTCTTCATTCATCTCCC No data
Right 1140967042 16:79976983-79977005 ATTTCCTTCTTCCACGTTAATGG No data
1140967035_1140967042 30 Left 1140967035 16:79976930-79976952 CCAAACCAAAACTCTTCATTCAT No data
Right 1140967042 16:79976983-79977005 ATTTCCTTCTTCCACGTTAATGG No data
1140967038_1140967042 4 Left 1140967038 16:79976956-79976978 CCCACATTCTAAACTCTTCCTCT No data
Right 1140967042 16:79976983-79977005 ATTTCCTTCTTCCACGTTAATGG No data
1140967039_1140967042 3 Left 1140967039 16:79976957-79976979 CCACATTCTAAACTCTTCCTCTG No data
Right 1140967042 16:79976983-79977005 ATTTCCTTCTTCCACGTTAATGG No data
1140967037_1140967042 5 Left 1140967037 16:79976955-79976977 CCCCACATTCTAAACTCTTCCTC No data
Right 1140967042 16:79976983-79977005 ATTTCCTTCTTCCACGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140967042 Original CRISPR ATTTCCTTCTTCCACGTTAA TGG Intergenic