ID: 1140967045

View in Genome Browser
Species Human (GRCh38)
Location 16:79977009-79977031
Sequence TAACCACCACCCCATTGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140967040_1140967045 12 Left 1140967040 16:79976974-79976996 CCTCTGCCAATTTCCTTCTTCCA No data
Right 1140967045 16:79977009-79977031 TAACCACCACCCCATTGCTCAGG No data
1140967039_1140967045 29 Left 1140967039 16:79976957-79976979 CCACATTCTAAACTCTTCCTCTG 0: 1
1: 0
2: 4
3: 36
4: 420
Right 1140967045 16:79977009-79977031 TAACCACCACCCCATTGCTCAGG No data
1140967041_1140967045 6 Left 1140967041 16:79976980-79977002 CCAATTTCCTTCTTCCACGTTAA No data
Right 1140967045 16:79977009-79977031 TAACCACCACCCCATTGCTCAGG No data
1140967043_1140967045 -1 Left 1140967043 16:79976987-79977009 CCTTCTTCCACGTTAATGGCACT No data
Right 1140967045 16:79977009-79977031 TAACCACCACCCCATTGCTCAGG No data
1140967038_1140967045 30 Left 1140967038 16:79976956-79976978 CCCACATTCTAAACTCTTCCTCT No data
Right 1140967045 16:79977009-79977031 TAACCACCACCCCATTGCTCAGG No data
1140967044_1140967045 -8 Left 1140967044 16:79976994-79977016 CCACGTTAATGGCACTAACCACC No data
Right 1140967045 16:79977009-79977031 TAACCACCACCCCATTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140967045 Original CRISPR TAACCACCACCCCATTGCTC AGG Intergenic