ID: 1140969057

View in Genome Browser
Species Human (GRCh38)
Location 16:79995363-79995385
Sequence GTTCATTCTAGGCCTTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140969057_1140969061 28 Left 1140969057 16:79995363-79995385 CCTTGGCAAGGCCTAGAATGAAC No data
Right 1140969061 16:79995414-79995436 AGTCTGGCTTTGTCTACCTGCGG No data
1140969057_1140969060 12 Left 1140969057 16:79995363-79995385 CCTTGGCAAGGCCTAGAATGAAC No data
Right 1140969060 16:79995398-79995420 TGAGGCTATTTGCTGAAGTCTGG No data
1140969057_1140969059 -6 Left 1140969057 16:79995363-79995385 CCTTGGCAAGGCCTAGAATGAAC No data
Right 1140969059 16:79995380-79995402 ATGAACAGTTGTTGTGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140969057 Original CRISPR GTTCATTCTAGGCCTTGCCA AGG (reversed) Intergenic
No off target data available for this crispr