ID: 1140970718

View in Genome Browser
Species Human (GRCh38)
Location 16:80009862-80009884
Sequence GGGAGCCTGGTTCATGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140970718_1140970724 11 Left 1140970718 16:80009862-80009884 CCTGAGACATGAACCAGGCTCCC No data
Right 1140970724 16:80009896-80009918 CAAATTTCAAAGCAAAGCATGGG No data
1140970718_1140970725 23 Left 1140970718 16:80009862-80009884 CCTGAGACATGAACCAGGCTCCC No data
Right 1140970725 16:80009908-80009930 CAAAGCATGGGTCAGTTATTAGG No data
1140970718_1140970723 10 Left 1140970718 16:80009862-80009884 CCTGAGACATGAACCAGGCTCCC No data
Right 1140970723 16:80009895-80009917 CCAAATTTCAAAGCAAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140970718 Original CRISPR GGGAGCCTGGTTCATGTCTC AGG (reversed) Intergenic
No off target data available for this crispr