ID: 1140970721

View in Genome Browser
Species Human (GRCh38)
Location 16:80009883-80009905
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140970721_1140970726 18 Left 1140970721 16:80009883-80009905 CCAAGTGAAGCTCCAAATTTCAA No data
Right 1140970726 16:80009924-80009946 TATTAGGAGCCCTTGTTTTCTGG No data
1140970721_1140970728 25 Left 1140970721 16:80009883-80009905 CCAAGTGAAGCTCCAAATTTCAA No data
Right 1140970728 16:80009931-80009953 AGCCCTTGTTTTCTGGACCTGGG No data
1140970721_1140970724 -10 Left 1140970721 16:80009883-80009905 CCAAGTGAAGCTCCAAATTTCAA No data
Right 1140970724 16:80009896-80009918 CAAATTTCAAAGCAAAGCATGGG No data
1140970721_1140970725 2 Left 1140970721 16:80009883-80009905 CCAAGTGAAGCTCCAAATTTCAA No data
Right 1140970725 16:80009908-80009930 CAAAGCATGGGTCAGTTATTAGG No data
1140970721_1140970727 24 Left 1140970721 16:80009883-80009905 CCAAGTGAAGCTCCAAATTTCAA No data
Right 1140970727 16:80009930-80009952 GAGCCCTTGTTTTCTGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140970721 Original CRISPR TTGAAATTTGGAGCTTCACT TGG (reversed) Intergenic
No off target data available for this crispr