ID: 1140970722

View in Genome Browser
Species Human (GRCh38)
Location 16:80009895-80009917
Sequence CCATGCTTTGCTTTGAAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140970722_1140970727 12 Left 1140970722 16:80009895-80009917 CCAAATTTCAAAGCAAAGCATGG No data
Right 1140970727 16:80009930-80009952 GAGCCCTTGTTTTCTGGACCTGG No data
1140970722_1140970725 -10 Left 1140970722 16:80009895-80009917 CCAAATTTCAAAGCAAAGCATGG No data
Right 1140970725 16:80009908-80009930 CAAAGCATGGGTCAGTTATTAGG No data
1140970722_1140970726 6 Left 1140970722 16:80009895-80009917 CCAAATTTCAAAGCAAAGCATGG No data
Right 1140970726 16:80009924-80009946 TATTAGGAGCCCTTGTTTTCTGG No data
1140970722_1140970728 13 Left 1140970722 16:80009895-80009917 CCAAATTTCAAAGCAAAGCATGG No data
Right 1140970728 16:80009931-80009953 AGCCCTTGTTTTCTGGACCTGGG No data
1140970722_1140970731 27 Left 1140970722 16:80009895-80009917 CCAAATTTCAAAGCAAAGCATGG No data
Right 1140970731 16:80009945-80009967 GGACCTGGGTTATCCTTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140970722 Original CRISPR CCATGCTTTGCTTTGAAATT TGG (reversed) Intergenic
No off target data available for this crispr