ID: 1140970725

View in Genome Browser
Species Human (GRCh38)
Location 16:80009908-80009930
Sequence CAAAGCATGGGTCAGTTATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140970719_1140970725 10 Left 1140970719 16:80009875-80009897 CCAGGCTCCCAAGTGAAGCTCCA No data
Right 1140970725 16:80009908-80009930 CAAAGCATGGGTCAGTTATTAGG No data
1140970721_1140970725 2 Left 1140970721 16:80009883-80009905 CCAAGTGAAGCTCCAAATTTCAA No data
Right 1140970725 16:80009908-80009930 CAAAGCATGGGTCAGTTATTAGG No data
1140970720_1140970725 3 Left 1140970720 16:80009882-80009904 CCCAAGTGAAGCTCCAAATTTCA No data
Right 1140970725 16:80009908-80009930 CAAAGCATGGGTCAGTTATTAGG No data
1140970722_1140970725 -10 Left 1140970722 16:80009895-80009917 CCAAATTTCAAAGCAAAGCATGG No data
Right 1140970725 16:80009908-80009930 CAAAGCATGGGTCAGTTATTAGG No data
1140970718_1140970725 23 Left 1140970718 16:80009862-80009884 CCTGAGACATGAACCAGGCTCCC No data
Right 1140970725 16:80009908-80009930 CAAAGCATGGGTCAGTTATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140970725 Original CRISPR CAAAGCATGGGTCAGTTATT AGG Intergenic
No off target data available for this crispr