ID: 1140970984

View in Genome Browser
Species Human (GRCh38)
Location 16:80012194-80012216
Sequence GCGTGTATTAGCAGCACGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140970980_1140970984 6 Left 1140970980 16:80012165-80012187 CCTTTAAACTTTAACCTAGAAGC No data
Right 1140970984 16:80012194-80012216 GCGTGTATTAGCAGCACGGGAGG No data
1140970981_1140970984 -8 Left 1140970981 16:80012179-80012201 CCTAGAAGCAACACAGCGTGTAT No data
Right 1140970984 16:80012194-80012216 GCGTGTATTAGCAGCACGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140970984 Original CRISPR GCGTGTATTAGCAGCACGGG AGG Intergenic
No off target data available for this crispr