ID: 1140972318

View in Genome Browser
Species Human (GRCh38)
Location 16:80025236-80025258
Sequence ACCCCTGGTTGGAGATCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140972314_1140972318 -3 Left 1140972314 16:80025216-80025238 CCCACTGGCTTTAGTTCGCAACC No data
Right 1140972318 16:80025236-80025258 ACCCCTGGTTGGAGATCAACAGG No data
1140972315_1140972318 -4 Left 1140972315 16:80025217-80025239 CCACTGGCTTTAGTTCGCAACCC No data
Right 1140972318 16:80025236-80025258 ACCCCTGGTTGGAGATCAACAGG No data
1140972312_1140972318 18 Left 1140972312 16:80025195-80025217 CCGGCAACTGGCTGCATTTGGCC No data
Right 1140972318 16:80025236-80025258 ACCCCTGGTTGGAGATCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140972318 Original CRISPR ACCCCTGGTTGGAGATCAAC AGG Intergenic
No off target data available for this crispr