ID: 1140973203

View in Genome Browser
Species Human (GRCh38)
Location 16:80033349-80033371
Sequence GAGAAAAAGGGGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140973196_1140973203 18 Left 1140973196 16:80033308-80033330 CCACATATGGAATTGGAGACAAA No data
Right 1140973203 16:80033349-80033371 GAGAAAAAGGGGAAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140973203 Original CRISPR GAGAAAAAGGGGAAAGAGGA AGG Intergenic
No off target data available for this crispr