ID: 1140973829

View in Genome Browser
Species Human (GRCh38)
Location 16:80040367-80040389
Sequence TTTGTGATGAAACATTTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140973828_1140973829 30 Left 1140973828 16:80040314-80040336 CCTGGAAAATTGCAATGTGGCTC No data
Right 1140973829 16:80040367-80040389 TTTGTGATGAAACATTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140973829 Original CRISPR TTTGTGATGAAACATTTGCC AGG Intergenic
No off target data available for this crispr