ID: 1140978160

View in Genome Browser
Species Human (GRCh38)
Location 16:80080844-80080866
Sequence CTCTGCTACAGTTTGAGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140978160_1140978167 21 Left 1140978160 16:80080844-80080866 CCTTGCCTCAAACTGTAGCAGAG No data
Right 1140978167 16:80080888-80080910 GCACTAAGGAGGAAGAGGTGGGG No data
1140978160_1140978166 20 Left 1140978160 16:80080844-80080866 CCTTGCCTCAAACTGTAGCAGAG No data
Right 1140978166 16:80080887-80080909 AGCACTAAGGAGGAAGAGGTGGG No data
1140978160_1140978172 30 Left 1140978160 16:80080844-80080866 CCTTGCCTCAAACTGTAGCAGAG No data
Right 1140978172 16:80080897-80080919 AGGAAGAGGTGGGGCGGTGGGGG No data
1140978160_1140978169 27 Left 1140978160 16:80080844-80080866 CCTTGCCTCAAACTGTAGCAGAG No data
Right 1140978169 16:80080894-80080916 AGGAGGAAGAGGTGGGGCGGTGG No data
1140978160_1140978164 16 Left 1140978160 16:80080844-80080866 CCTTGCCTCAAACTGTAGCAGAG No data
Right 1140978164 16:80080883-80080905 AGAAAGCACTAAGGAGGAAGAGG No data
1140978160_1140978165 19 Left 1140978160 16:80080844-80080866 CCTTGCCTCAAACTGTAGCAGAG No data
Right 1140978165 16:80080886-80080908 AAGCACTAAGGAGGAAGAGGTGG No data
1140978160_1140978170 28 Left 1140978160 16:80080844-80080866 CCTTGCCTCAAACTGTAGCAGAG No data
Right 1140978170 16:80080895-80080917 GGAGGAAGAGGTGGGGCGGTGGG No data
1140978160_1140978162 7 Left 1140978160 16:80080844-80080866 CCTTGCCTCAAACTGTAGCAGAG No data
Right 1140978162 16:80080874-80080896 CAGAGAGAAAGAAAGCACTAAGG No data
1140978160_1140978171 29 Left 1140978160 16:80080844-80080866 CCTTGCCTCAAACTGTAGCAGAG No data
Right 1140978171 16:80080896-80080918 GAGGAAGAGGTGGGGCGGTGGGG No data
1140978160_1140978168 24 Left 1140978160 16:80080844-80080866 CCTTGCCTCAAACTGTAGCAGAG No data
Right 1140978168 16:80080891-80080913 CTAAGGAGGAAGAGGTGGGGCGG No data
1140978160_1140978163 10 Left 1140978160 16:80080844-80080866 CCTTGCCTCAAACTGTAGCAGAG No data
Right 1140978163 16:80080877-80080899 AGAGAAAGAAAGCACTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140978160 Original CRISPR CTCTGCTACAGTTTGAGGCA AGG (reversed) Intergenic
No off target data available for this crispr