ID: 1140978622

View in Genome Browser
Species Human (GRCh38)
Location 16:80084702-80084724
Sequence GACGCTAATCTTGAGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140978622_1140978625 12 Left 1140978622 16:80084702-80084724 CCTTTCTCCTCAAGATTAGCGTC No data
Right 1140978625 16:80084737-80084759 GCCTTTAAAAAGCAGCCCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140978622 Original CRISPR GACGCTAATCTTGAGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr