ID: 1140979542

View in Genome Browser
Species Human (GRCh38)
Location 16:80093623-80093645
Sequence CTGCTTTCTTGGGGCAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140979542_1140979548 0 Left 1140979542 16:80093623-80093645 CCAGGTTTGCCCCAAGAAAGCAG No data
Right 1140979548 16:80093646-80093668 GAGTATCAAGAGGAGATGACAGG No data
1140979542_1140979547 -10 Left 1140979542 16:80093623-80093645 CCAGGTTTGCCCCAAGAAAGCAG No data
Right 1140979547 16:80093636-80093658 AAGAAAGCAGGAGTATCAAGAGG No data
1140979542_1140979549 7 Left 1140979542 16:80093623-80093645 CCAGGTTTGCCCCAAGAAAGCAG No data
Right 1140979549 16:80093653-80093675 AAGAGGAGATGACAGGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140979542 Original CRISPR CTGCTTTCTTGGGGCAAACC TGG (reversed) Intergenic
No off target data available for this crispr