ID: 1140980989

View in Genome Browser
Species Human (GRCh38)
Location 16:80109144-80109166
Sequence ATTGTGACTGAGAGCCAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140980986_1140980989 -8 Left 1140980986 16:80109129-80109151 CCCTCCTGTGTGCAGATTGTGAC No data
Right 1140980989 16:80109144-80109166 ATTGTGACTGAGAGCCAACATGG No data
1140980982_1140980989 8 Left 1140980982 16:80109113-80109135 CCACCAACACCCAAGACCCTCCT No data
Right 1140980989 16:80109144-80109166 ATTGTGACTGAGAGCCAACATGG No data
1140980987_1140980989 -9 Left 1140980987 16:80109130-80109152 CCTCCTGTGTGCAGATTGTGACT No data
Right 1140980989 16:80109144-80109166 ATTGTGACTGAGAGCCAACATGG No data
1140980981_1140980989 9 Left 1140980981 16:80109112-80109134 CCCACCAACACCCAAGACCCTCC No data
Right 1140980989 16:80109144-80109166 ATTGTGACTGAGAGCCAACATGG No data
1140980983_1140980989 5 Left 1140980983 16:80109116-80109138 CCAACACCCAAGACCCTCCTGTG No data
Right 1140980989 16:80109144-80109166 ATTGTGACTGAGAGCCAACATGG No data
1140980985_1140980989 -2 Left 1140980985 16:80109123-80109145 CCAAGACCCTCCTGTGTGCAGAT No data
Right 1140980989 16:80109144-80109166 ATTGTGACTGAGAGCCAACATGG No data
1140980984_1140980989 -1 Left 1140980984 16:80109122-80109144 CCCAAGACCCTCCTGTGTGCAGA No data
Right 1140980989 16:80109144-80109166 ATTGTGACTGAGAGCCAACATGG No data
1140980980_1140980989 22 Left 1140980980 16:80109099-80109121 CCAACAAACAATGCCCACCAACA No data
Right 1140980989 16:80109144-80109166 ATTGTGACTGAGAGCCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140980989 Original CRISPR ATTGTGACTGAGAGCCAACA TGG Intergenic
No off target data available for this crispr