ID: 1140981179

View in Genome Browser
Species Human (GRCh38)
Location 16:80111246-80111268
Sequence GTTTTGCTCTGAGCTGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140981175_1140981179 26 Left 1140981175 16:80111197-80111219 CCCAAGTAGCTCGGGCTACAGGC No data
Right 1140981179 16:80111246-80111268 GTTTTGCTCTGAGCTGAATCAGG No data
1140981173_1140981179 29 Left 1140981173 16:80111194-80111216 CCTCCCAAGTAGCTCGGGCTACA No data
Right 1140981179 16:80111246-80111268 GTTTTGCTCTGAGCTGAATCAGG No data
1140981176_1140981179 25 Left 1140981176 16:80111198-80111220 CCAAGTAGCTCGGGCTACAGGCT No data
Right 1140981179 16:80111246-80111268 GTTTTGCTCTGAGCTGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140981179 Original CRISPR GTTTTGCTCTGAGCTGAATC AGG Intergenic