ID: 1140981492

View in Genome Browser
Species Human (GRCh38)
Location 16:80113764-80113786
Sequence AAGTGTCAACACTCTGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140981491_1140981492 1 Left 1140981491 16:80113740-80113762 CCTTTAGGATTGGGAGAGGCTAT No data
Right 1140981492 16:80113764-80113786 AAGTGTCAACACTCTGAGCAAGG No data
1140981486_1140981492 25 Left 1140981486 16:80113716-80113738 CCAGAATGAAAATTCAGGTGCTT No data
Right 1140981492 16:80113764-80113786 AAGTGTCAACACTCTGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140981492 Original CRISPR AAGTGTCAACACTCTGAGCA AGG Intergenic
No off target data available for this crispr