ID: 1140988533

View in Genome Browser
Species Human (GRCh38)
Location 16:80184973-80184995
Sequence GATTTCCACCAGCAGTTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140988533_1140988535 14 Left 1140988533 16:80184973-80184995 CCATACAACTGCTGGTGGAAATC No data
Right 1140988535 16:80185010-80185032 TACTTTAGAAAGCAGCTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140988533 Original CRISPR GATTTCCACCAGCAGTTGTA TGG (reversed) Intergenic
No off target data available for this crispr