ID: 1140988535

View in Genome Browser
Species Human (GRCh38)
Location 16:80185010-80185032
Sequence TACTTTAGAAAGCAGCTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140988533_1140988535 14 Left 1140988533 16:80184973-80184995 CCATACAACTGCTGGTGGAAATC No data
Right 1140988535 16:80185010-80185032 TACTTTAGAAAGCAGCTTAGTGG No data
1140988532_1140988535 15 Left 1140988532 16:80184972-80184994 CCCATACAACTGCTGGTGGAAAT No data
Right 1140988535 16:80185010-80185032 TACTTTAGAAAGCAGCTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140988535 Original CRISPR TACTTTAGAAAGCAGCTTAG TGG Intergenic
No off target data available for this crispr