ID: 1140991786

View in Genome Browser
Species Human (GRCh38)
Location 16:80219996-80220018
Sequence GTGCCGTTTTTTAAGCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140991786_1140991790 3 Left 1140991786 16:80219996-80220018 CCAACCAGCTTAAAAAACGGCAC No data
Right 1140991790 16:80220022-80220044 AGGAGATTATATACCACACATGG No data
1140991786_1140991795 26 Left 1140991786 16:80219996-80220018 CCAACCAGCTTAAAAAACGGCAC No data
Right 1140991795 16:80220045-80220067 CTTGGAGGGACCTAGACCCAAGG No data
1140991786_1140991793 12 Left 1140991786 16:80219996-80220018 CCAACCAGCTTAAAAAACGGCAC No data
Right 1140991793 16:80220031-80220053 TATACCACACATGGCTTGGAGGG No data
1140991786_1140991792 11 Left 1140991786 16:80219996-80220018 CCAACCAGCTTAAAAAACGGCAC No data
Right 1140991792 16:80220030-80220052 ATATACCACACATGGCTTGGAGG No data
1140991786_1140991791 8 Left 1140991786 16:80219996-80220018 CCAACCAGCTTAAAAAACGGCAC No data
Right 1140991791 16:80220027-80220049 ATTATATACCACACATGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140991786 Original CRISPR GTGCCGTTTTTTAAGCTGGT TGG (reversed) Intergenic
No off target data available for this crispr