ID: 1140991791

View in Genome Browser
Species Human (GRCh38)
Location 16:80220027-80220049
Sequence ATTATATACCACACATGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140991784_1140991791 25 Left 1140991784 16:80219979-80220001 CCTAATACTGCACTTTTCCAACC No data
Right 1140991791 16:80220027-80220049 ATTATATACCACACATGGCTTGG No data
1140991787_1140991791 4 Left 1140991787 16:80220000-80220022 CCAGCTTAAAAAACGGCACACCA No data
Right 1140991791 16:80220027-80220049 ATTATATACCACACATGGCTTGG No data
1140991782_1140991791 29 Left 1140991782 16:80219975-80219997 CCACCCTAATACTGCACTTTTCC 0: 533
1: 1120
2: 1947
3: 1274
4: 1322
Right 1140991791 16:80220027-80220049 ATTATATACCACACATGGCTTGG No data
1140991781_1140991791 30 Left 1140991781 16:80219974-80219996 CCCACCCTAATACTGCACTTTTC 0: 559
1: 1129
2: 2179
3: 1911
4: 923
Right 1140991791 16:80220027-80220049 ATTATATACCACACATGGCTTGG No data
1140991786_1140991791 8 Left 1140991786 16:80219996-80220018 CCAACCAGCTTAAAAAACGGCAC No data
Right 1140991791 16:80220027-80220049 ATTATATACCACACATGGCTTGG No data
1140991783_1140991791 26 Left 1140991783 16:80219978-80220000 CCCTAATACTGCACTTTTCCAAC 0: 217
1: 767
2: 1271
3: 1832
4: 1515
Right 1140991791 16:80220027-80220049 ATTATATACCACACATGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140991791 Original CRISPR ATTATATACCACACATGGCT TGG Intergenic
No off target data available for this crispr