ID: 1140991792

View in Genome Browser
Species Human (GRCh38)
Location 16:80220030-80220052
Sequence ATATACCACACATGGCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140991783_1140991792 29 Left 1140991783 16:80219978-80220000 CCCTAATACTGCACTTTTCCAAC 0: 217
1: 767
2: 1271
3: 1832
4: 1515
Right 1140991792 16:80220030-80220052 ATATACCACACATGGCTTGGAGG No data
1140991787_1140991792 7 Left 1140991787 16:80220000-80220022 CCAGCTTAAAAAACGGCACACCA No data
Right 1140991792 16:80220030-80220052 ATATACCACACATGGCTTGGAGG No data
1140991784_1140991792 28 Left 1140991784 16:80219979-80220001 CCTAATACTGCACTTTTCCAACC No data
Right 1140991792 16:80220030-80220052 ATATACCACACATGGCTTGGAGG No data
1140991786_1140991792 11 Left 1140991786 16:80219996-80220018 CCAACCAGCTTAAAAAACGGCAC No data
Right 1140991792 16:80220030-80220052 ATATACCACACATGGCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140991792 Original CRISPR ATATACCACACATGGCTTGG AGG Intergenic
No off target data available for this crispr