ID: 1140991795

View in Genome Browser
Species Human (GRCh38)
Location 16:80220045-80220067
Sequence CTTGGAGGGACCTAGACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140991786_1140991795 26 Left 1140991786 16:80219996-80220018 CCAACCAGCTTAAAAAACGGCAC No data
Right 1140991795 16:80220045-80220067 CTTGGAGGGACCTAGACCCAAGG No data
1140991789_1140991795 2 Left 1140991789 16:80220020-80220042 CCAGGAGATTATATACCACACAT No data
Right 1140991795 16:80220045-80220067 CTTGGAGGGACCTAGACCCAAGG No data
1140991787_1140991795 22 Left 1140991787 16:80220000-80220022 CCAGCTTAAAAAACGGCACACCA No data
Right 1140991795 16:80220045-80220067 CTTGGAGGGACCTAGACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140991795 Original CRISPR CTTGGAGGGACCTAGACCCA AGG Intergenic
No off target data available for this crispr