ID: 1140996675

View in Genome Browser
Species Human (GRCh38)
Location 16:80266616-80266638
Sequence CTGATGCAACAGAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140996668_1140996675 19 Left 1140996668 16:80266574-80266596 CCTTTCTTAGGTTAAAAGAAAGG No data
Right 1140996675 16:80266616-80266638 CTGATGCAACAGAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140996675 Original CRISPR CTGATGCAACAGAAGGAAGA GGG Intergenic
No off target data available for this crispr