ID: 1140997984

View in Genome Browser
Species Human (GRCh38)
Location 16:80279593-80279615
Sequence CAGAGCTCCCACAGTGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140997984_1140997990 19 Left 1140997984 16:80279593-80279615 CCTGGTTCACTGTGGGAGCTCTG No data
Right 1140997990 16:80279635-80279657 TTGTAAAGATGGAGAAGACAGGG No data
1140997984_1140997987 -4 Left 1140997984 16:80279593-80279615 CCTGGTTCACTGTGGGAGCTCTG No data
Right 1140997987 16:80279612-80279634 TCTGGGAATGTCAGCAGTGATGG No data
1140997984_1140997989 18 Left 1140997984 16:80279593-80279615 CCTGGTTCACTGTGGGAGCTCTG No data
Right 1140997989 16:80279634-80279656 GTTGTAAAGATGGAGAAGACAGG No data
1140997984_1140997988 8 Left 1140997984 16:80279593-80279615 CCTGGTTCACTGTGGGAGCTCTG No data
Right 1140997988 16:80279624-80279646 AGCAGTGATGGTTGTAAAGATGG No data
1140997984_1140997991 20 Left 1140997984 16:80279593-80279615 CCTGGTTCACTGTGGGAGCTCTG No data
Right 1140997991 16:80279636-80279658 TGTAAAGATGGAGAAGACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140997984 Original CRISPR CAGAGCTCCCACAGTGAACC AGG (reversed) Intergenic
No off target data available for this crispr