ID: 1140997988

View in Genome Browser
Species Human (GRCh38)
Location 16:80279624-80279646
Sequence AGCAGTGATGGTTGTAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140997983_1140997988 9 Left 1140997983 16:80279592-80279614 CCCTGGTTCACTGTGGGAGCTCT No data
Right 1140997988 16:80279624-80279646 AGCAGTGATGGTTGTAAAGATGG No data
1140997979_1140997988 26 Left 1140997979 16:80279575-80279597 CCTTGTGAGGTTCGTGACCCTGG No data
Right 1140997988 16:80279624-80279646 AGCAGTGATGGTTGTAAAGATGG No data
1140997984_1140997988 8 Left 1140997984 16:80279593-80279615 CCTGGTTCACTGTGGGAGCTCTG No data
Right 1140997988 16:80279624-80279646 AGCAGTGATGGTTGTAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140997988 Original CRISPR AGCAGTGATGGTTGTAAAGA TGG Intergenic
No off target data available for this crispr