ID: 1140997990

View in Genome Browser
Species Human (GRCh38)
Location 16:80279635-80279657
Sequence TTGTAAAGATGGAGAAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140997983_1140997990 20 Left 1140997983 16:80279592-80279614 CCCTGGTTCACTGTGGGAGCTCT No data
Right 1140997990 16:80279635-80279657 TTGTAAAGATGGAGAAGACAGGG No data
1140997984_1140997990 19 Left 1140997984 16:80279593-80279615 CCTGGTTCACTGTGGGAGCTCTG No data
Right 1140997990 16:80279635-80279657 TTGTAAAGATGGAGAAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140997990 Original CRISPR TTGTAAAGATGGAGAAGACA GGG Intergenic
No off target data available for this crispr