ID: 1140998240

View in Genome Browser
Species Human (GRCh38)
Location 16:80282106-80282128
Sequence AACCTTTAACTACTATTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140998240_1140998244 25 Left 1140998240 16:80282106-80282128 CCCACAAATAGTAGTTAAAGGTT No data
Right 1140998244 16:80282154-80282176 AAGTGGATCTAAAGAGTACCTGG No data
1140998240_1140998242 8 Left 1140998240 16:80282106-80282128 CCCACAAATAGTAGTTAAAGGTT No data
Right 1140998242 16:80282137-80282159 GCAAAATTATAGACCAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140998240 Original CRISPR AACCTTTAACTACTATTTGT GGG (reversed) Intergenic
No off target data available for this crispr