ID: 1141000477

View in Genome Browser
Species Human (GRCh38)
Location 16:80302883-80302905
Sequence TTCAAGATGAGATTTGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40136
Summary {0: 7463, 1: 11190, 2: 9643, 3: 7118, 4: 4722}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141000477_1141000488 22 Left 1141000477 16:80302883-80302905 CCCCACCCAAATCTCATCTTGAA 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
Right 1141000488 16:80302928-80302950 GTGTCATGAGAGGGACCCCGTGG No data
1141000477_1141000484 12 Left 1141000477 16:80302883-80302905 CCCCACCCAAATCTCATCTTGAA 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
Right 1141000484 16:80302918-80302940 CAGTTCCCACGTGTCATGAGAGG No data
1141000477_1141000489 23 Left 1141000477 16:80302883-80302905 CCCCACCCAAATCTCATCTTGAA 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
Right 1141000489 16:80302929-80302951 TGTCATGAGAGGGACCCCGTGGG No data
1141000477_1141000490 26 Left 1141000477 16:80302883-80302905 CCCCACCCAAATCTCATCTTGAA 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
Right 1141000490 16:80302932-80302954 CATGAGAGGGACCCCGTGGGAGG No data
1141000477_1141000485 13 Left 1141000477 16:80302883-80302905 CCCCACCCAAATCTCATCTTGAA 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
Right 1141000485 16:80302919-80302941 AGTTCCCACGTGTCATGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141000477 Original CRISPR TTCAAGATGAGATTTGGGTG GGG (reversed) Intergenic
Too many off-targets to display for this crispr