ID: 1141000478

View in Genome Browser
Species Human (GRCh38)
Location 16:80302884-80302906
Sequence ATTCAAGATGAGATTTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 42911
Summary {0: 7461, 1: 10942, 2: 10318, 3: 7687, 4: 6503}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141000478_1141000485 12 Left 1141000478 16:80302884-80302906 CCCACCCAAATCTCATCTTGAAT 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
Right 1141000485 16:80302919-80302941 AGTTCCCACGTGTCATGAGAGGG No data
1141000478_1141000484 11 Left 1141000478 16:80302884-80302906 CCCACCCAAATCTCATCTTGAAT 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
Right 1141000484 16:80302918-80302940 CAGTTCCCACGTGTCATGAGAGG No data
1141000478_1141000489 22 Left 1141000478 16:80302884-80302906 CCCACCCAAATCTCATCTTGAAT 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
Right 1141000489 16:80302929-80302951 TGTCATGAGAGGGACCCCGTGGG No data
1141000478_1141000488 21 Left 1141000478 16:80302884-80302906 CCCACCCAAATCTCATCTTGAAT 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
Right 1141000488 16:80302928-80302950 GTGTCATGAGAGGGACCCCGTGG No data
1141000478_1141000490 25 Left 1141000478 16:80302884-80302906 CCCACCCAAATCTCATCTTGAAT 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
Right 1141000490 16:80302932-80302954 CATGAGAGGGACCCCGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141000478 Original CRISPR ATTCAAGATGAGATTTGGGT GGG (reversed) Intergenic
Too many off-targets to display for this crispr