ID: 1141000479

View in Genome Browser
Species Human (GRCh38)
Location 16:80302885-80302907
Sequence AATTCAAGATGAGATTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43710
Summary {0: 7468, 1: 11239, 2: 9760, 3: 8452, 4: 6791}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141000479_1141000490 24 Left 1141000479 16:80302885-80302907 CCACCCAAATCTCATCTTGAATT 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
Right 1141000490 16:80302932-80302954 CATGAGAGGGACCCCGTGGGAGG No data
1141000479_1141000485 11 Left 1141000479 16:80302885-80302907 CCACCCAAATCTCATCTTGAATT 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
Right 1141000485 16:80302919-80302941 AGTTCCCACGTGTCATGAGAGGG No data
1141000479_1141000484 10 Left 1141000479 16:80302885-80302907 CCACCCAAATCTCATCTTGAATT 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
Right 1141000484 16:80302918-80302940 CAGTTCCCACGTGTCATGAGAGG No data
1141000479_1141000488 20 Left 1141000479 16:80302885-80302907 CCACCCAAATCTCATCTTGAATT 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
Right 1141000488 16:80302928-80302950 GTGTCATGAGAGGGACCCCGTGG No data
1141000479_1141000489 21 Left 1141000479 16:80302885-80302907 CCACCCAAATCTCATCTTGAATT 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
Right 1141000489 16:80302929-80302951 TGTCATGAGAGGGACCCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141000479 Original CRISPR AATTCAAGATGAGATTTGGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr