ID: 1141000480

View in Genome Browser
Species Human (GRCh38)
Location 16:80302888-80302910
Sequence TACAATTCAAGATGAGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39211
Summary {0: 6802, 1: 10434, 2: 9513, 3: 7783, 4: 4679}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141000480_1141000484 7 Left 1141000480 16:80302888-80302910 CCCAAATCTCATCTTGAATTGTA 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
Right 1141000484 16:80302918-80302940 CAGTTCCCACGTGTCATGAGAGG No data
1141000480_1141000489 18 Left 1141000480 16:80302888-80302910 CCCAAATCTCATCTTGAATTGTA 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
Right 1141000489 16:80302929-80302951 TGTCATGAGAGGGACCCCGTGGG No data
1141000480_1141000488 17 Left 1141000480 16:80302888-80302910 CCCAAATCTCATCTTGAATTGTA 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
Right 1141000488 16:80302928-80302950 GTGTCATGAGAGGGACCCCGTGG No data
1141000480_1141000485 8 Left 1141000480 16:80302888-80302910 CCCAAATCTCATCTTGAATTGTA 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
Right 1141000485 16:80302919-80302941 AGTTCCCACGTGTCATGAGAGGG No data
1141000480_1141000490 21 Left 1141000480 16:80302888-80302910 CCCAAATCTCATCTTGAATTGTA 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
Right 1141000490 16:80302932-80302954 CATGAGAGGGACCCCGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141000480 Original CRISPR TACAATTCAAGATGAGATTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr