ID: 1141000481

View in Genome Browser
Species Human (GRCh38)
Location 16:80302889-80302911
Sequence CTACAATTCAAGATGAGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38431
Summary {0: 4048, 1: 7216, 2: 8939, 3: 8984, 4: 9244}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141000481_1141000489 17 Left 1141000481 16:80302889-80302911 CCAAATCTCATCTTGAATTGTAG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
Right 1141000489 16:80302929-80302951 TGTCATGAGAGGGACCCCGTGGG No data
1141000481_1141000488 16 Left 1141000481 16:80302889-80302911 CCAAATCTCATCTTGAATTGTAG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
Right 1141000488 16:80302928-80302950 GTGTCATGAGAGGGACCCCGTGG No data
1141000481_1141000490 20 Left 1141000481 16:80302889-80302911 CCAAATCTCATCTTGAATTGTAG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
Right 1141000490 16:80302932-80302954 CATGAGAGGGACCCCGTGGGAGG No data
1141000481_1141000485 7 Left 1141000481 16:80302889-80302911 CCAAATCTCATCTTGAATTGTAG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
Right 1141000485 16:80302919-80302941 AGTTCCCACGTGTCATGAGAGGG No data
1141000481_1141000484 6 Left 1141000481 16:80302889-80302911 CCAAATCTCATCTTGAATTGTAG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
Right 1141000484 16:80302918-80302940 CAGTTCCCACGTGTCATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141000481 Original CRISPR CTACAATTCAAGATGAGATT TGG (reversed) Intergenic
Too many off-targets to display for this crispr