ID: 1141000483

View in Genome Browser
Species Human (GRCh38)
Location 16:80302915-80302937
Sequence CTCATGACACGTGGGAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141000483_1141000489 -9 Left 1141000483 16:80302915-80302937 CCACAGTTCCCACGTGTCATGAG No data
Right 1141000489 16:80302929-80302951 TGTCATGAGAGGGACCCCGTGGG No data
1141000483_1141000494 8 Left 1141000483 16:80302915-80302937 CCACAGTTCCCACGTGTCATGAG No data
Right 1141000494 16:80302946-80302968 CGTGGGAGGTGACTGAATCATGG 0: 4
1: 185
2: 2487
3: 9532
4: 12620
1141000483_1141000488 -10 Left 1141000483 16:80302915-80302937 CCACAGTTCCCACGTGTCATGAG No data
Right 1141000488 16:80302928-80302950 GTGTCATGAGAGGGACCCCGTGG No data
1141000483_1141000496 12 Left 1141000483 16:80302915-80302937 CCACAGTTCCCACGTGTCATGAG No data
Right 1141000496 16:80302950-80302972 GGAGGTGACTGAATCATGGTGGG No data
1141000483_1141000498 17 Left 1141000483 16:80302915-80302937 CCACAGTTCCCACGTGTCATGAG No data
Right 1141000498 16:80302955-80302977 TGACTGAATCATGGTGGGGCAGG No data
1141000483_1141000490 -6 Left 1141000483 16:80302915-80302937 CCACAGTTCCCACGTGTCATGAG No data
Right 1141000490 16:80302932-80302954 CATGAGAGGGACCCCGTGGGAGG No data
1141000483_1141000497 13 Left 1141000483 16:80302915-80302937 CCACAGTTCCCACGTGTCATGAG No data
Right 1141000497 16:80302951-80302973 GAGGTGACTGAATCATGGTGGGG No data
1141000483_1141000495 11 Left 1141000483 16:80302915-80302937 CCACAGTTCCCACGTGTCATGAG No data
Right 1141000495 16:80302949-80302971 GGGAGGTGACTGAATCATGGTGG 0: 138
1: 1814
2: 8001
3: 11252
4: 11538

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141000483 Original CRISPR CTCATGACACGTGGGAACTG TGG (reversed) Intergenic
No off target data available for this crispr