ID: 1141000488

View in Genome Browser
Species Human (GRCh38)
Location 16:80302928-80302950
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141000480_1141000488 17 Left 1141000480 16:80302888-80302910 CCCAAATCTCATCTTGAATTGTA 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
Right 1141000488 16:80302928-80302950 GTGTCATGAGAGGGACCCCGTGG No data
1141000481_1141000488 16 Left 1141000481 16:80302889-80302911 CCAAATCTCATCTTGAATTGTAG 0: 4048
1: 7216
2: 8939
3: 8984
4: 9244
Right 1141000488 16:80302928-80302950 GTGTCATGAGAGGGACCCCGTGG No data
1141000478_1141000488 21 Left 1141000478 16:80302884-80302906 CCCACCCAAATCTCATCTTGAAT 0: 7461
1: 10942
2: 10318
3: 7687
4: 6503
Right 1141000488 16:80302928-80302950 GTGTCATGAGAGGGACCCCGTGG No data
1141000479_1141000488 20 Left 1141000479 16:80302885-80302907 CCACCCAAATCTCATCTTGAATT 0: 7468
1: 11239
2: 9760
3: 8452
4: 6791
Right 1141000488 16:80302928-80302950 GTGTCATGAGAGGGACCCCGTGG No data
1141000482_1141000488 -9 Left 1141000482 16:80302914-80302936 CCCACAGTTCCCACGTGTCATGA No data
Right 1141000488 16:80302928-80302950 GTGTCATGAGAGGGACCCCGTGG No data
1141000477_1141000488 22 Left 1141000477 16:80302883-80302905 CCCCACCCAAATCTCATCTTGAA 0: 7463
1: 11190
2: 9643
3: 7118
4: 4722
Right 1141000488 16:80302928-80302950 GTGTCATGAGAGGGACCCCGTGG No data
1141000483_1141000488 -10 Left 1141000483 16:80302915-80302937 CCACAGTTCCCACGTGTCATGAG No data
Right 1141000488 16:80302928-80302950 GTGTCATGAGAGGGACCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141000488 Original CRISPR GTGTCATGAGAGGGACCCCG TGG Intergenic
No off target data available for this crispr