ID: 1141001559

View in Genome Browser
Species Human (GRCh38)
Location 16:80313017-80313039
Sequence AACAAGGATGTGGGTGCAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141001556_1141001559 -8 Left 1141001556 16:80313002-80313024 CCAAAAGGACAACAAAACAAGGA No data
Right 1141001559 16:80313017-80313039 AACAAGGATGTGGGTGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141001559 Original CRISPR AACAAGGATGTGGGTGCAAG TGG Intergenic
No off target data available for this crispr