ID: 1141002108

View in Genome Browser
Species Human (GRCh38)
Location 16:80317830-80317852
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141002099_1141002108 13 Left 1141002099 16:80317794-80317816 CCTTACAAGACTGCAGCAGGCTG No data
Right 1141002108 16:80317830-80317852 GGCAGGCGCCAGTGTGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141002108 Original CRISPR GGCAGGCGCCAGTGTGGGCA AGG Intergenic
No off target data available for this crispr