ID: 1141004627

View in Genome Browser
Species Human (GRCh38)
Location 16:80340363-80340385
Sequence CACAGCCCAAATCCTCTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141004627_1141004628 0 Left 1141004627 16:80340363-80340385 CCTGAAAGAGGATTTGGGCTGTG No data
Right 1141004628 16:80340386-80340408 CAGCTCTATGTCTGCCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141004627 Original CRISPR CACAGCCCAAATCCTCTTTC AGG (reversed) Intergenic
No off target data available for this crispr