ID: 1141006891

View in Genome Browser
Species Human (GRCh38)
Location 16:80360771-80360793
Sequence CAGTGATGGAGAAACAGATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141006891_1141006896 4 Left 1141006891 16:80360771-80360793 CCTTATCTGTTTCTCCATCACTG No data
Right 1141006896 16:80360798-80360820 CTTGGCACTCAGCACATACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141006891 Original CRISPR CAGTGATGGAGAAACAGATA AGG (reversed) Intergenic