ID: 1141006896

View in Genome Browser
Species Human (GRCh38)
Location 16:80360798-80360820
Sequence CTTGGCACTCAGCACATACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141006891_1141006896 4 Left 1141006891 16:80360771-80360793 CCTTATCTGTTTCTCCATCACTG No data
Right 1141006896 16:80360798-80360820 CTTGGCACTCAGCACATACCTGG No data
1141006895_1141006896 -10 Left 1141006895 16:80360785-80360807 CCATCACTGGGAGCTTGGCACTC No data
Right 1141006896 16:80360798-80360820 CTTGGCACTCAGCACATACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141006896 Original CRISPR CTTGGCACTCAGCACATACC TGG Intergenic