ID: 1141008525

View in Genome Browser
Species Human (GRCh38)
Location 16:80375677-80375699
Sequence CCACCCATCTCAGCTAGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141008522_1141008525 15 Left 1141008522 16:80375639-80375661 CCCTATATTCAGAGGACAATTTT No data
Right 1141008525 16:80375677-80375699 CCACCCATCTCAGCTAGAGTTGG No data
1141008523_1141008525 14 Left 1141008523 16:80375640-80375662 CCTATATTCAGAGGACAATTTTA No data
Right 1141008525 16:80375677-80375699 CCACCCATCTCAGCTAGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141008525 Original CRISPR CCACCCATCTCAGCTAGAGT TGG Intergenic
No off target data available for this crispr